In a little known recent development, the Human Genome Project has discovered that
everyone is born with a finite number of possible keystrokes. Dr. Stanley Musscheiss,
Deputy Director of the Project’s ATGGTAGGAATTAGGTAGTA Section reported late
yesterday (that would have been around 1816 EST, 23 March 2004) that research in his
section “absolutely confirmed beyond any shadow of a doubt” that anyone sharing his
sectional DNA sequence “will almost always” be limited to no more than 3.14159265 x
10³⁷ keystrokes in a normal lifetime. When asked about this number being so similar to π,
he replied, “Amazing that a reporter like you would notice that too.”

Unless you want to be profligate with your lifetime supply of keystrokes, you might want
to have your DNA sequenced. Remember, once they’re gone, they’re gone.