Lyrics & Knowledge Personal Pages Record Shop Auction Links Radio & Media Kids Membership Help
The Mudcat Cafemuddy

Post to this Thread - Printer Friendly - Home
Page: [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] [115] [116] [117] [118] [119] [120] [121] [122] [123] [124] [125] [126] [127] [128] [129] [130] [131] [132] [133] [134] [135] [136] [137] [138] [139] [140] [141] [142] [143] [144] [145] [146] [147] [148] [149] [150] [151] [152] [153] [154] [155] [156] [157] [158] [159] [160] [161] [162] [163] [164] [165] [166] [167] [168] [169] [170] [171] [172] [173] [174] [175] [176] [177] [178] [179] [180] [181] [182] [183] [184] [185] [186] [187] [188] [189] [190] [191] [192] [193] [194] [195] [196] [197] [198] [199] [200] [201] [202] [203] [204] [205] [206] [207] [208] [209] [210] [211] [212] [213] [214] [215] [216] [217] [218] [219] [220] [221] [222] [223] [224] [225] [226] [227] [228] [229] [230] [231] [232] [233] [234] [235] [236] [237] [238] [239] [240] [241] [242] [243] [244] [245] [246] [247] [248] [249] [250] [251] [252] [253] [254] [255] [256] [257] [258] [259] [260] [261] [262] [263] [264] [265] [266] [267] [268] [269] [270] [271] [272] [273] [274] [275] [276] [277] [278] [279] [280] [281] [282] [283] [284] [285] [286] [287] [288] [289] [290] [291] [292] [293] [294] [295] [296] [297] [298] [299] [300] [301] [302] [303] [304] [305] [306] [307] [308] [309] [310] [311] [312] [313] [314] [315] [316] [317] [318] [319] [320] [321] [322] [323] [324] [325] [326] [327] [328] [329] [330] [331] [332] [333] [334] [335] [336] [337] [338] [339] [340] [341] [342] [343] [344] [345] [346] [347] [348] [349] [350] [351] [352] [353] [354] [355] [356] [357] [358] [359] [360] [361] [362] [363] [364] [365] [366] [367] [368] [369] [370] [371] [372] [373] [374] [375] [376] [377] [378] [379] [380] [381] [382] [383] [384] [385] [386] [387] [388] [389] [390] [391] [392] [393] [394] [395] [396] [397] [398] [399] [400] [401] [402] [403] [404] [405] [406] [407] [408] [409] [410] [411] [412] [413] [414] [415] [416] [417] [418] [419] [420] [421] [422] [423] [424] [425] [426] [427] [428] [429] [430] [431] [432] [433] [434] [435] [436] [437] [438] [439] [440] [441] [442] [443] [444] [445] [446] [447] [448] [449] [450] [451] [452] [453] [454] [455] [456] [457] [458] [459] [460] [461] [462] [463] [464] [465] [466] [467] [468] [469] [470] [471] [472] [473] [474] [475] [476] [477] [478] [479] [480] [481] [482] [483] [484] [485] [486] [487] [488] [489] [490] [491] [492] [493] [494] [495] [496] [497] [498] [499] [500] [501] [502] [503] [504] [505] [506] [507] [508] [509] [510] [511] [512] [513] [514] [515] [516] [517] [518] [519] [520] [521] [522] [523] [524] [525] [526] [527] [528] [529] [530] [531] [532] [533] [534] [535] [536] [537] [538] [539] [540] [541] [542] [543] [544] [545] [546] [547] [548] [549] [550] [551] [552] [553] [554] [555] [556] [557] [558] [559] [560] [561] [562] [563] [564] [565] [566] [567] [568] [569] [570] [571] [572] [573] [574] [575] [576] [577] [578] [579] [580] [581] [582] [583] [584] [585] [586] [587] [588] [589] [590] [591] [592] [593] [594] [595] [596] [597] [598] [599] [600] [601] [602] [603] [604] [605] [606] [607] [608] [609] [610] [611] [612] [613] [614] [615] [616] [617] [618] [619] [620] [621] [622] [623] [624] [625] [626] [627] [628] [629] [630] [631] [632] [633] [634] [635] [636] [637] [638] [639] [640] [641] [642] [643] [644] [645] [646] [647] [648] [649] [650] [651] [652] [653] [654] [655] [656] [657] [658] [659] [660] [661] [662] [663] [664] [665] [666] [667] [668] [669] [670] [671] [672] [673] [674] [675] [676] [677] [678] [679] [680] [681] [682] [683] [684] [685] [686] [687] [688] [689] [690] [691] [692] [693] [694] [695] [696] [697] [698] [699] [700] [701] [702] [703] [704] [705] [706] [707] [708] [709] [710] [711] [712] [713] [714] [715] [716] [717] [718] [719] [720] [721] [722] [723] [724] [725] [726] [727] [728] [729] [730] [731] [732] [733] [734] [735] [736] [737] [738] [739] [740] [741] [742] [743] [744] [745] [746] [747] [748] [749] [750] [751] [752] [753] [754] [755] [756] [757] [758] [759] [760] [761] [762] [763] [764] [765] [766] [767] [768] [769] [770] [771] [772] [773] [774] [775] [776] [777] [778] [779] [780] [781] [782] [783] [784] [785] [786] [787] [788] [789] [790] [791] [792] [793] [794] [795] [796] [797] [798] [799] [800] [801] [802] [803] [804] [805] [806] [807] [808] [809] [810] [811] [812] [813] [814] [815] [816] [817] [818] [819] [820] [821] [822] [823] [824] [825] [826] [827] [828] [829] [830] [831] [832] [833] [834] [835] [836] [837] [838] [839] [840] [841] [842] [843] [844] [845] [846] [847] [848] [849] [850] [851] [852] [853] [854] [855] [856] [857] [858] [859] [860] [861] [862] [863] [864] [865] [866] [867] [868] [869] [870] [871] [872] [873] [874] [875] [876] [877] [878] [879] [880] [881] [882] [883] [884] [885] [886] [887] [888] [889] [890] [891] [892] [893] [894] [895] [896] [897] [898] [899] [900] [901] [902] [903] [904] [905] [906] [907] [908] [909] [910] [911] [912] [913] [914] [915] [916] [917] [918] [919] [920] [921] [922] [923] [924] [925] [926] [927] [928] [929] [930] [931] [932] [933] [934] [935] [936] [937] [938] [939] [940] [941] [942] [943] [944] [945] [946] [947] [948] [949] [950] [951] [952] [953] [954] [955] [956] [957] [958] [959] [960] [961] [962] [963] [964] [965] [966] [967] [968] [969] [970] [971] [972] [973] [974] [975] [976] [977] [978] [979] [980] [981] [982] [983] [984] [985] [986] [987] [988] [989] [990] [991] [992] [993] [994] [995] [996] [997] [998] [999] [1000] [1001] [1002] [1003] [1004] [1005] [1006] [1007] [1008] [1009] [1010] [1011] [1012] [1013] [1014] [1015] [1016] [1017] [1018] [1019] [1020] [1021] [1022] [1023] [1024] [1025] [1026] [1027] [1028] [1029] [1030] [1031] [1032] [1033] [1034] [1035] [1036] [1037] [1038] [1039] [1040] [1041] [1042] [1043] [1044] [1045] [1046] [1047] [1048] [1049] [1050] [1051] [1052] [1053] [1054] [1055] [1056] [1057] [1058] [1059] [1060] [1061] [1062] [1063] [1064] [1065] [1066] [1067] [1068] [1069] [1070] [1071] [1072] [1073] [1074] [1075] [1076] [1077] [1078] [1079] [1080] [1081] [1082] [1083] [1084] [1085] [1086] [1087] [1088] [1089] [1090] [1091] [1092] [1093] [1094] [1095] [1096] [1097] [1098] [1099] [1100] [1101] [1102] [1103] [1104] [1105] [1106] [1107] [1108] [1109] [1110] [1111] [1112] [1113] [1114] [1115] [1116] [1117] [1118] [1119] [1120] [1121] [1122] [1123] [1124] [1125] [1126] [1127] [1128] [1129] [1130] [1131] [1132] [1133] [1134]

BS: The Mother of all BS threads

Rapparee 20 Mar 04 - 10:12 AM
GUEST,Dee Keednappers 20 Mar 04 - 10:31 AM
Amos 20 Mar 04 - 10:55 AM
Rapparee 20 Mar 04 - 07:39 PM
Little Hawk 20 Mar 04 - 08:02 PM
Bee-dubya-ell 20 Mar 04 - 09:29 PM
Rapparee 20 Mar 04 - 10:48 PM
GUEST,Dee Keednappers 20 Mar 04 - 11:18 PM
Acme 21 Mar 04 - 12:31 AM
Amos 21 Mar 04 - 12:33 AM
Bee-dubya-ell 21 Mar 04 - 08:19 AM
Rapparee 21 Mar 04 - 09:56 AM
Bee-dubya-ell 21 Mar 04 - 10:13 AM
Amos 21 Mar 04 - 10:28 AM
GUEST,Shlio 21 Mar 04 - 11:14 AM
Amos 21 Mar 04 - 11:52 AM
Amos 21 Mar 04 - 08:17 PM
Rapparee 21 Mar 04 - 08:42 PM
Amos 22 Mar 04 - 11:44 AM
Rapparee 23 Mar 04 - 08:55 AM
Amos 23 Mar 04 - 09:10 AM
Bee-dubya-ell 23 Mar 04 - 10:50 AM
Bee-dubya-ell 23 Mar 04 - 10:51 AM
Amos 23 Mar 04 - 10:59 AM
Bee-dubya-ell 23 Mar 04 - 11:26 AM
Rapparee 23 Mar 04 - 11:56 AM
Rapparee 23 Mar 04 - 01:14 PM
GUEST,Shlio 23 Mar 04 - 03:14 PM
Amos 23 Mar 04 - 03:50 PM
Rapparee 23 Mar 04 - 04:29 PM
Amos 23 Mar 04 - 06:04 PM
GUEST,Shlio 24 Mar 04 - 07:09 AM
Rapparee 24 Mar 04 - 02:35 PM
Amos 24 Mar 04 - 02:51 PM
Rapparee 24 Mar 04 - 03:42 PM
Amos 24 Mar 04 - 04:34 PM
Rapparee 24 Mar 04 - 04:48 PM
Tweed 25 Mar 04 - 07:40 AM
Amos 25 Mar 04 - 09:02 AM
Little Hawk 25 Mar 04 - 11:12 AM
Amos 25 Mar 04 - 11:31 AM
Rapparee 25 Mar 04 - 11:42 AM
Amos 25 Mar 04 - 11:57 AM
Little Hawk 25 Mar 04 - 12:14 PM
Rapparee 25 Mar 04 - 01:01 PM
Amos 25 Mar 04 - 01:05 PM
Bee-dubya-ell 25 Mar 04 - 05:27 PM
GUEST,Shlio 25 Mar 04 - 06:26 PM
Amos 25 Mar 04 - 06:47 PM
Rapparee 25 Mar 04 - 06:50 PM
Lyrics & Knowledge Search [Advanced]
DT  Forum
Sort (Forum) by:relevance date
DT Lyrics:

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 20 Mar 04 - 10:12 AM

Tweed, could he be being held hostage at the Rock and Roll Hall of Fame?

Surely he wouldn't go there voluntarily.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Dee Keednappers
Date: 20 Mar 04 - 10:31 AM

Si, jou eempeerialeest Yankee scum! Wee hab jour Keeng khandu! Ees not een no steenkin' Cleeveland though, jou dumbass buncha Greengo twits! Ees een fookin' Toleedo! Jou weel never find heem!

We weel advize jou of our ransom deemands for thees worthless sack of Meessisseeppee sheet een our next post. Start savin' jour pesos jou buncha broke-deek assholes or jou weel never see jour Keeng ageen!

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 20 Mar 04 - 10:55 AM

Khandu? Has he been away????


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 20 Mar 04 - 07:39 PM

I dunno if it's worth going to Toledo to save Khandu. I mean, LA or Manhattan would be bad enough, but Toledo?

Unless it's not the one in Ohio?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 20 Mar 04 - 08:02 PM

Yeah. Ohio is the state that contains Spaw. Avoid the place, I say! However, to save Khandu I would be willing to go almost anywhere. But not Schenectady. Or Blind River.

- LH

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 20 Mar 04 - 09:29 PM

Errrr... Judging from the accents of the kidnappers, it may be possible that our King is being held in Toledo Spain! No way to know for certain until they place their ransom demands, but if it is Toledo, Spain, I'll go. I've never been to Spain, but I kinda like the music. They say the ladies are insane there, and they sure know how to use it. They don't abuse it. Never gonna lose it. I can't refuse it.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 20 Mar 04 - 10:48 PM

Yeah, I'll go to the one in Spain. As far as I know I've never been to Spain. Can we snag a C-141 Starlifter? I'll bring the whole Idaho Legion if we can. They've never been to Spain either, although they do frequent some Mexican restaurants and drink tequila (well, they do -- they also drink paint thinner, squeeze Sterno, and make their own from ingredients I can't bring myself to describe).

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Dee Keednappers
Date: 20 Mar 04 - 11:18 PM

Jou sheetbirds only weesh wee had your Keeng khandu een Toleedo, Spain! Sorry, but jou guessed wrong! Ees Toleedo, Ohio! Ees reely dee asshole of dee Junited States. Maybee dee asshole of dee whole fookin' world. Great place to keep asshole like khandu!

Hokay! Here's dee deal. Wee want ten meelion of jour US dollars to geeve thees khandu prick back to jou. Eef jou cannot come up with ten meelion dollars, wee might consider a hostage exchange. Wee will geeve khandu to jou if jou weel give us William Shatner or Bob Deelan in exchange. Ees fair deel, no?

Seegnal jour acceptance of our terms by typing the word "uncle" someplace in dee next ten posts to thees thread.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Acme
Date: 21 Mar 04 - 12:31 AM

If we give you 11 million, will you keep him?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 12:33 AM

Shatner's the best deal.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 21 Mar 04 - 08:19 AM

Khandu plays guitar better than Bob Dylan or William Shatner. Khandu sings better than Bob Dylan or William Shatner. Only problem is khandu is a fan of both Bob Dylan and William Shatner so he probably wouldn't want either one of them to sacrifice on his behalf. Maybe the kidnappers would be amenable to further negotiations. Let's offer 'em Keith Richard. Hell, by all rights he should have been dead years ago so it wouldn't be a great loss.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 21 Mar 04 - 09:56 AM

Hey, did you all know that with this posting MOAB will be closing in on 2,400 posts? And just spittin' distance from 2,500? Khandu would be sooooooooooooooooooooooooooooooooooooo proud, if he could be found.

Maybe he's no longer alive! We could have one helluva funeral!

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 21 Mar 04 - 10:13 AM

Khandu does these periodic disappearing acts so the rest of us can entertain ourselves by making up goofy shit about his whereabouts. Truly a mark of enlightened royalty - making sure the rabble has something to do other than staging revolts. If the Romanovs had only invented the Internet and given away free memberships to "Asian Babes with Big Bazoongas" Lenin would've just been another wanker.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 10:28 AM

Lenin would've just been another wanker.

Which indeed would have changed very little.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 21 Mar 04 - 11:14 AM

Personally I would be happy to sacrifice Shatner to get Khandu back. Heck, I'd give Shatner away even if Khandu hadn't been kidnapped.

But not Dylan, okay?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 11:52 AM

There ya go. Shlio-who-is-not-Shhilo has aspoken!

Let it be so!!

Shatner's outta here and Khandu is on his long wayback to MOAB!!

Hurray for Khanduuuu!

Down with Shatner!!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 08:17 PM

Death is a place where even MOAB's reach will not avail and all the laughter stills; there is no BS like the cosmic crap that says Rick Fielding has to go be someone else, and we take the loss of it. Now that, friends, is BS. I protest it to my shoes.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 21 Mar 04 - 08:42 PM

Damned straight, Amos. But I'd like to think that MOAB's and Mudcat's reach extends to Rick even now.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 22 Mar 04 - 11:44 AM

MOAB pentrates the Veil? Wow. (I love that idea -- one of my favorite conceits is that our laughter ripples through the Universe of the Spirits and shifts the fate of nations by lightening things up a bit at the Source). So here's to you, Rick -- you always made things lighter!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 08:55 AM

No, no, Amos! MOAB has taken the veil! You may now refer to Mother as Merry Mother Mary MOAB, SDF.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 09:10 AM

(Sings)Venn the veil made shtrike
Undt der line paid out
Undt der veil made a blunder mitt her tail.....

I refuse to engage in More Meaningless Machinations Making More Mealymouth Overblown Acronyms, Brother! (MMMMMMOAB!)


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 10:50 AM

I have noticed that I seem to be the only MOABite who has held to the convention of using boldface type when typing MOAB or Mother of all BS threads. Emboldening the holy name of this thread (as was done by the Prophet khandu on MOAB Day One) indicates a level of reverance above and beyond that of those who simply type "MOAB".

Now, I don't have any problem with you let's-do-it-the-easy-way backsliders being too lazy to type an extra seven keystrokes if that's the extent of your faith, but I personally wish to proclaim the name of MOAB boldly.

Yes, you can call be a MOAB fundamentalist if you wish. It's the truth. I don't deny it. And I challenge you to join me. Yes, to join me under the MOAB Revival Tent. Stand up and say, "I'm a MOABite and proud of it! And I will always refer to our MOAB in foldface type! Now hand me one of those snakes!"

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 10:51 AM

Don't ask me what in the buck "foldface" type is.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 10:59 AM

Foldface is a new wrinkle on typography, appropriate for aging boomers all over the land who have first-hand experience with their faces folding more and more each year.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 11:26 AM

My problem's not with my face folding, but with it stretching. My face used to end about 1 1/2" above my eyebrows, where it met my hairline. Then it began stretching. Unfortunately, as the face stretched the head itself didn't grow to accomodate more face. So, that hairline just kept being pushed further and further back. Now, my face extends back a full 10" from my eyebrows.

Meanwhile, a lot of that displaced hair seems to have migrated to the lower part of my face, but that's another story.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 11:56 AM

Mayhap, Bee-Dubya, it's because some of us Moabites don't know HTML and really don't want to learn it?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 01:14 PM

Tthose who cannot cope with simple HTML most certainly will never be able to cope with XML ! ! !

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 23 Mar 04 - 03:14 PM

Hey! I can do italics now!

I just happen to be a slow learner.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 03:50 PM


How nice that you have mastered the "X" of XML.

But there is only one "T" in "Those".


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 04:29 PM

Wwhat, Aamos? Yyou ddon't kknow Wwelsh?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 06:04 PM

Terrible about ole Rapaire -- world's first case of Parkinson in ASCII ever recorded!!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 24 Mar 04 - 07:09 AM

Besides, for us slow typers, HTML takes too long to use it on such a common word as MOAB

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 02:35 PM

In a little known recent development, the Human Genome Project has discovered that
everyone is born with a finite number of possible keystrokes. Dr. Stanley Musscheiss,
Deputy Director of the Project’s ATGGTAGGAATTAGGTAGTA Section reported late
yesterday (that would have been around 1816 EST, 23 March 2004) that research in his
section “absolutely confirmed beyond any shadow of a doubt” that anyone sharing his
sectional DNA sequence “will almost always” be limited to no more than 3.14159265 x
1037 keystrokes in a normal lifetime. When asked about this number being so similar to π,
he replied, “Amazing that a reporter like you would notice that too.”

Unless you want to be profligate with your lifetime supply of keystrokes, you might want
to have your DNA sequenced. Remember, once they’re gone, they’re gone.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 24 Mar 04 - 02:51 PM

I don't think pi x 10^37 is right, Rapaire. Where did you get that figure from? I am sure it is an order of magnitude high.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 03:42 PM

That's Musscheiss's figure, Amos, not mine.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 24 Mar 04 - 04:34 PM

Obviously Liebenscheiss and Mussscheiss disagree by an order of magnitude.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 04:48 PM

I suppose that could be. I understand, from the article I read on it, that Musscheiss's methodology was to to count the number of genetic pentagroups in the DNA segment and multiply, in base 10, by 5.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Tweed
Date: 25 Mar 04 - 07:40 AM

DNA Discorses?? Pitiful!...a mos' pitimous attempt at BS. Surely thar must be someone wif a Hellenic Hint fore the use obv scouring powder to remove corns and callussez....

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 09:02 AM

Hellenic Hint:

Don't use scouring powder on large wooden horses as it causes those within to sneeze.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 25 Mar 04 - 11:12 AM

N'hurgy! N'hurgy! Nyaaaahhhh!!! Wacka! Wacka! Freeble.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 11:31 AM

Little Hawk has succumbed to the delusion that he is still a primate.

This is a great loss to the MOAB, as his lucid rationalisms will be buried in the language of the lizard-brained Silverbacks and we will not be able to understand him.

On the other hand, think of the disk space we'll save!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 11:42 AM

Hellenic hint: Just let the soap lay there on the floor.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 11:57 AM


See this reference


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 25 Mar 04 - 12:14 PM

You live on this thread don't you, Amos? :-)

Mr Chongo is getting restless. He wants to do another story.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 01:01 PM

Hellenic Hint #2: Have Amos pick up the soap for you.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 01:05 PM

Hellenic Hint # 3: Don't use scouring powder on young boys, Rapire.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 25 Mar 04 - 05:27 PM

After reading several of Amos and Rapaire's little pseudo-intellectual sparring matches I've come to an inescapable conclusion: You guys really should get married.

Think about it! We haven't yet had a MOAB wedding! It'd be fun. We could send out invitations. Khandu could preside and Joe Offer could give away the bride. We could do it live in the Mudchat room if we wanted.

Yeah, I know, Amos and Rapaire are probably gonna make with a buncha "but I'm already married" noise and "but I'm not gay" crap. So, get friggin' divorces! People do it all the time for helluva lot worse reasons. And don't worry about the gay thing. You guys are too old for sex of any kind anyway.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 25 Mar 04 - 06:26 PM

Well, it would mean that they could have their cosy DNA and soap chats in the privacy of their own home...stop giving us poor readers headaches...

Sounds like a good idea!

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 06:47 PM

Excellent, excellent idea, with only one fatal flaw. I'm ugly.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 06:50 PM

And I'm stunningly good looking.

Post - Top - Home - Printer Friendly - Translate
Next Page


You must be a member to post in non-music threads. Join here.

You must be a member to post in non-music threads. Join here.

Mudcat time: 22 October 3:49 PM EDT

[ Home ]

All original material is copyright © 1998 by the Mudcat Café Music Foundation, Inc. All photos, music, images, etc. are copyright © by their rightful owners. Every effort is taken to attribute appropriate copyright to images, content, music, etc. We are not a copyright resource.