BS: The Mother of all BS threads

Subject: RE: BS: The Mother of all BS threads
From: Acme
Date: 28 Mar 04 - 01:03 PM

Wow! Maybe I finally killed the MOAB. Got the last word. Stopped those guys in their tracks.

Subject: RE: BS: The Mother of all BS threads
From: Acme
Date: 28 Mar 04 - 11:29 AM

You are cordially invited
to Mudcat's first three-way-swing,
featuring Amos, Rapaire, and Bee-Dubya-Ell.
Send the kids to be before proceeding with this thread.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 28 Mar 04 - 10:57 AM

OK!! I just didn't want to haul this long thread up from the bottom three times in a row!


A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 28 Mar 04 - 10:41 AM

No, me! Me! Me!

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 27 Mar 04 - 11:40 PM

So am I the appointed heavy lifter these days?

A

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 27 Mar 04 - 10:36 AM

It didn't expire, Rapire, you just used up all the rides on it.

A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 27 Mar 04 - 09:53 AM

I suppose I could get remarried to my current wife. Would that work? Our marriage license did expire some years back.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 27 Mar 04 - 12:22 AM

Aw, BWL, you're just making excuses and you know it. Let us hear when you want to say what you honestly feel, man...

A

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 26 Mar 04 - 09:43 PM

Sorry, Rap, I'm still in mourning for Bubba Bubba. Talk to me after a year has gone by.

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Pussy Galore
Date: 26 Mar 04 - 04:54 PM

And he loves cats!

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 26 Mar 04 - 04:12 PM

Brucie not female? Well -- I wouldn't go THAT far...he certainly gives it all he's got!
But there are some orgnic varieties in these parts make him look like mere shadowstuff.


A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 26 Mar 04 - 03:38 PM

Amos, are you implying that Bee-dubya isn't, well, female????

Subject: RE: BS: The Mother of all BS threads
From: Skipjack K8
Date: 26 Mar 04 - 02:24 PM

I'm worried that my contribution is a little premature, and that this fledgling thread still might not catch on. I'm also a certified thread killer, so this has probably consigned this thread to Davy Jones' Locker.

That's an each-way bet to kill this mother.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 26 Mar 04 - 01:34 PM

There you have it, TV Viewers -- it is suddenly revealed that BWL was merely pulling strings to set me up in an effort to dump Rapaire his own self. Now, I know that affairs of the heart are complicated and tricky -- but we have to maintain stability here. So you boys go off and have your tete-a-tete and sort out the destiny of your relationship and I'll go one dreaming about the womenfolk of Mudcat far and wide. Some further, and some wider... 'Kay? Thanks.


A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 26 Mar 04 - 01:26 PM

But, Bee-dubya, what about us?

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 25 Mar 04 - 08:45 PM

See, just like an old married couple. Bitch, bitch, bitch about nothing of any consequence and then, BOOM! "I love you!"

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 08:13 PM

I love ya, man.

A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 08:04 PM

I'm a true pod! Nothing psuedo about me!

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 07:20 PM

And, just BTW, what the hell do you mean PSEUDO-intellectual??

I am an intellectual. Rapaire is a pseudopod.

A

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 25 Mar 04 - 06:51 PM

On the other hand...Who would post to MOAB ?

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 06:50 PM

And I'm stunningly good looking.
2400!!!

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 06:47 PM

Excellent, excellent idea, with only one fatal flaw. I'm ugly.

A

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 25 Mar 04 - 06:26 PM

Well, it would mean that they could have their cosy DNA and soap chats in the privacy of their own home...stop giving us poor readers headaches...

Sounds like a good idea!

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 25 Mar 04 - 05:27 PM

After reading several of Amos and Rapaire's little pseudo-intellectual sparring matches I've come to an inescapable conclusion: You guys really should get married.

Think about it! We haven't yet had a MOAB wedding! It'd be fun. We could send out invitations. Khandu could preside and Joe Offer could give away the bride. We could do it live in the Mudchat room if we wanted.

Yeah, I know, Amos and Rapaire are probably gonna make with a buncha "but I'm already married" noise and "but I'm not gay" crap. So, get friggin' divorces! People do it all the time for helluva lot worse reasons. And don't worry about the gay thing. You guys are too old for sex of any kind anyway.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 01:05 PM

Hellenic Hint # 3: Don't use scouring powder on young boys, Rapire.

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 01:01 PM

Hellenic Hint #2: Have Amos pick up the soap for you.

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 25 Mar 04 - 12:14 PM

You live on this thread don't you, Amos? :-)

Mr Chongo is getting restless. He wants to do another story.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 11:57 AM

Rapire:

See this reference

A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 11:42 AM

Hellenic hint: Just let the soap lay there on the floor.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 11:31 AM

Little Hawk has succumbed to the delusion that he is still a primate.

This is a great loss to the MOAB, as his lucid rationalisms will be buried in the language of the lizard-brained Silverbacks and we will not be able to understand him.

On the other hand, think of the disk space we'll save!


A

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 25 Mar 04 - 11:12 AM

N'hurgy! N'hurgy! Nyaaaahhhh!!! Wacka! Wacka! Freeble.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 09:02 AM

Hellenic Hint:

Don't use scouring powder on large wooden horses as it causes those within to sneeze.

A

Subject: RE: BS: The Mother of all BS threads
From: Tweed
Date: 25 Mar 04 - 07:40 AM

DNA Discorses?? Pitiful!...a mos' pitimous attempt at BS. Surely thar must be someone wif a Hellenic Hint fore the use obv scouring powder to remove corns and callussez....

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 04:48 PM

I suppose that could be. I understand, from the article I read on it, that Musscheiss's methodology was to to count the number of genetic pentagroups in the DNA segment and multiply, in base 10, by 5.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 24 Mar 04 - 04:34 PM

Obviously Liebenscheiss and Mussscheiss disagree by an order of magnitude.

A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 03:42 PM

That's Musscheiss's figure, Amos, not mine.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 24 Mar 04 - 02:51 PM

I don't think pi x 10^37 is right, Rapaire. Where did you get that figure from? I am sure it is an order of magnitude high.

A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 02:35 PM

In a little known recent development, the Human Genome Project has discovered that
everyone is born with a finite number of possible keystrokes. Dr. Stanley Musscheiss,
Deputy Director of the Project’s ATGGTAGGAATTAGGTAGTA Section reported late
yesterday (that would have been around 1816 EST, 23 March 2004) that research in his
section “absolutely confirmed beyond any shadow of a doubt” that anyone sharing his
sectional DNA sequence “will almost always” be limited to no more than 3.14159265 x
10³⁷ keystrokes in a normal lifetime. When asked about this number being so similar to π,
he replied, “Amazing that a reporter like you would notice that too.”

Unless you want to be profligate with your lifetime supply of keystrokes, you might want
to have your DNA sequenced. Remember, once they’re gone, they’re gone.

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 24 Mar 04 - 07:09 AM

Besides, for us slow typers, HTML takes too long to use it on such a common word as MOAB

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 06:04 PM

Terrible about ole Rapaire -- world's first case of Parkinson in ASCII ever recorded!!


A

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 04:29 PM

Wwhat, Aamos? Yyou ddon't kknow Wwelsh?

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 03:50 PM

Rapire:

How nice that you have mastered the "X" of XML.

But there is only one "T" in "Those".

A

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 23 Mar 04 - 03:14 PM

Hey! I can do italics now!

I just happen to be a slow learner.

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 01:14 PM

Tthose who cannot cope with simple HTML most certainly will never be able to cope with XML ! ! !

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 11:56 AM

Mayhap, Bee-Dubya, it's because some of us Moabites don't know HTML and really don't want to learn it?

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 11:26 AM

My problem's not with my face folding, but with it stretching. My face used to end about 1 1/2" above my eyebrows, where it met my hairline. Then it began stretching. Unfortunately, as the face stretched the head itself didn't grow to accomodate more face. So, that hairline just kept being pushed further and further back. Now, my face extends back a full 10" from my eyebrows.

Meanwhile, a lot of that displaced hair seems to have migrated to the lower part of my face, but that's another story.

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 10:59 AM

Foldface is a new wrinkle on typography, appropriate for aging boomers all over the land who have first-hand experience with their faces folding more and more each year.

A

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 10:51 AM

Don't ask me what in the buck "foldface" type is.

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 10:50 AM

I have noticed that I seem to be the only MOABite who has held to the convention of using boldface type when typing MOAB or Mother of all BS threads. Emboldening the holy name of this thread (as was done by the Prophet khandu on MOAB Day One) indicates a level of reverance above and beyond that of those who simply type "MOAB".

Now, I don't have any problem with you let's-do-it-the-easy-way backsliders being too lazy to type an extra seven keystrokes if that's the extent of your faith, but I personally wish to proclaim the name of MOAB boldly.

Yes, you can call be a MOAB fundamentalist if you wish. It's the truth. I don't deny it. And I challenge you to join me. Yes, to join me under the MOAB Revival Tent. Stand up and say, "I'm a MOABite and proud of it! And I will always refer to our MOAB in foldface type! Now hand me one of those snakes!"

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 09:10 AM

(Sings)Venn the veil made shtrike
Undt der line paid out
Undt der veil made a blunder mitt her tail.....


I refuse to engage in More Meaningless Machinations Making More Mealymouth Overblown Acronyms, Brother! (MMMMMMOAB!)


A