Lyrics & Knowledge Personal Pages Record Shop Auction Links Radio & Media Kids Membership Help
The Mudcat Cafemuddy

Post to this Thread - Printer Friendly - Home
Page: [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] [115] [116] [117] [118] [119] [120] [121] [122] [123] [124] [125] [126] [127] [128] [129] [130] [131] [132] [133] [134] [135] [136] [137] [138] [139] [140] [141] [142] [143] [144] [145] [146] [147] [148] [149] [150] [151] [152] [153] [154] [155] [156] [157] [158] [159] [160] [161] [162] [163] [164] [165] [166] [167] [168] [169] [170] [171] [172] [173] [174] [175] [176] [177] [178] [179] [180] [181] [182] [183] [184] [185] [186] [187] [188] [189] [190] [191] [192] [193] [194] [195] [196] [197] [198] [199] [200] [201] [202] [203] [204] [205] [206] [207] [208] [209] [210] [211] [212] [213] [214] [215] [216] [217] [218] [219] [220] [221] [222] [223] [224] [225] [226] [227] [228] [229] [230] [231] [232] [233] [234] [235] [236] [237] [238] [239] [240] [241] [242] [243] [244] [245] [246] [247] [248] [249] [250] [251] [252] [253] [254] [255] [256] [257] [258] [259] [260] [261] [262] [263] [264] [265] [266] [267] [268] [269] [270] [271] [272] [273] [274] [275] [276] [277] [278] [279] [280] [281] [282] [283] [284] [285] [286] [287] [288] [289] [290] [291] [292] [293] [294] [295] [296] [297] [298] [299] [300] [301] [302] [303] [304] [305] [306] [307] [308] [309] [310] [311] [312] [313] [314] [315] [316] [317] [318] [319] [320] [321] [322] [323] [324] [325] [326] [327] [328] [329] [330] [331] [332] [333] [334] [335] [336] [337] [338] [339] [340] [341] [342] [343] [344] [345] [346] [347] [348] [349] [350] [351] [352] [353] [354] [355] [356] [357] [358] [359] [360] [361] [362] [363] [364] [365] [366] [367] [368] [369] [370] [371] [372] [373] [374] [375] [376] [377] [378] [379] [380] [381] [382] [383] [384] [385] [386] [387] [388] [389] [390] [391] [392] [393] [394] [395] [396] [397] [398] [399] [400] [401] [402] [403] [404] [405] [406] [407] [408] [409] [410] [411] [412] [413] [414] [415] [416] [417] [418] [419] [420] [421] [422] [423] [424] [425] [426] [427] [428] [429] [430] [431] [432] [433] [434] [435] [436] [437] [438] [439] [440] [441] [442] [443] [444] [445] [446] [447] [448] [449] [450] [451] [452] [453] [454] [455] [456] [457] [458] [459] [460] [461] [462] [463] [464] [465] [466] [467] [468] [469] [470] [471] [472] [473] [474] [475] [476] [477] [478] [479] [480] [481] [482] [483] [484] [485] [486] [487] [488] [489] [490] [491] [492] [493] [494] [495] [496] [497] [498] [499] [500] [501] [502] [503] [504] [505] [506] [507] [508] [509] [510] [511] [512] [513] [514] [515] [516] [517] [518] [519] [520] [521] [522] [523] [524] [525] [526] [527] [528] [529] [530] [531] [532] [533] [534] [535] [536] [537] [538] [539] [540] [541] [542] [543] [544] [545] [546] [547] [548] [549] [550] [551] [552] [553] [554] [555] [556] [557] [558] [559] [560] [561] [562] [563] [564] [565] [566] [567] [568] [569] [570] [571] [572] [573] [574] [575] [576] [577] [578] [579] [580] [581] [582] [583] [584] [585] [586] [587] [588] [589] [590] [591] [592] [593] [594] [595] [596] [597] [598] [599] [600] [601] [602] [603] [604] [605] [606] [607] [608] [609] [610] [611] [612] [613] [614] [615] [616] [617] [618] [619] [620] [621] [622] [623] [624] [625] [626] [627] [628] [629] [630] [631] [632] [633] [634] [635] [636] [637] [638] [639] [640] [641] [642] [643] [644] [645] [646] [647] [648] [649] [650] [651] [652] [653] [654] [655] [656] [657] [658] [659] [660] [661] [662] [663] [664] [665] [666] [667] [668] [669] [670] [671] [672] [673] [674] [675] [676] [677] [678] [679] [680] [681] [682] [683] [684] [685] [686] [687] [688] [689] [690] [691] [692] [693] [694] [695] [696] [697] [698] [699] [700] [701] [702] [703] [704] [705] [706] [707] [708] [709] [710] [711] [712] [713] [714] [715] [716] [717] [718] [719] [720] [721] [722] [723] [724] [725] [726] [727] [728] [729] [730] [731] [732] [733] [734] [735] [736] [737] [738] [739] [740] [741] [742] [743] [744] [745] [746] [747] [748] [749] [750] [751] [752] [753] [754] [755] [756] [757] [758] [759] [760] [761] [762] [763] [764] [765] [766] [767] [768] [769] [770] [771] [772] [773] [774] [775] [776] [777] [778] [779] [780] [781] [782] [783] [784] [785] [786] [787] [788] [789] [790] [791] [792] [793] [794] [795] [796] [797] [798] [799] [800] [801] [802] [803] [804] [805] [806] [807] [808] [809] [810] [811] [812] [813] [814] [815] [816] [817] [818] [819] [820] [821] [822] [823] [824] [825] [826] [827] [828] [829] [830] [831] [832] [833] [834] [835] [836] [837] [838] [839] [840] [841] [842] [843] [844] [845] [846] [847] [848] [849] [850] [851] [852] [853] [854] [855] [856] [857] [858] [859] [860] [861] [862] [863] [864] [865] [866] [867] [868] [869] [870] [871] [872] [873] [874] [875] [876] [877] [878] [879] [880] [881] [882] [883] [884] [885] [886] [887] [888] [889] [890] [891] [892] [893] [894] [895] [896] [897] [898] [899] [900] [901] [902] [903] [904] [905] [906] [907] [908] [909] [910] [911] [912] [913] [914] [915] [916] [917] [918] [919] [920] [921] [922] [923] [924] [925] [926] [927] [928] [929] [930] [931] [932] [933] [934] [935] [936] [937] [938] [939] [940] [941] [942] [943] [944] [945] [946] [947] [948] [949] [950] [951] [952] [953] [954] [955] [956] [957] [958] [959] [960] [961] [962] [963] [964] [965] [966] [967] [968] [969] [970] [971] [972] [973] [974] [975] [976] [977] [978] [979] [980] [981] [982] [983] [984] [985] [986] [987] [988] [989] [990] [991] [992] [993] [994] [995] [996] [997] [998] [999] [1000] [1001] [1002] [1003] [1004] [1005] [1006] [1007] [1008] [1009] [1010] [1011] [1012] [1013] [1014] [1015] [1016] [1017] [1018] [1019] [1020] [1021] [1022] [1023] [1024] [1025] [1026] [1027] [1028] [1029] [1030] [1031] [1032] [1033] [1034] [1035] [1036] [1037] [1038] [1039] [1040] [1041] [1042] [1043] [1044] [1045] [1046] [1047] [1048] [1049] [1050] [1051] [1052] [1053] [1054] [1055] [1056] [1057] [1058] [1059] [1060] [1061] [1062] [1063] [1064] [1065] [1066] [1067] [1068] [1069] [1070] [1071] [1072] [1073] [1074] [1075] [1076] [1077] [1078] [1079] [1080] [1081] [1082] [1083] [1084] [1085] [1086] [1087] [1088] [1089] [1090] [1091] [1092] [1093] [1094] [1095] [1096] [1097] [1098] [1099] [1100] [1101] [1102] [1103] [1104] [1105] [1106] [1107] [1108] [1109] [1110] [1111] [1112] [1113] [1114] [1115] [1116] [1117] [1118] [1119] [1120] [1121] [1122] [1123] [1124] [1125] [1126] [1127] [1128] [1129] [1130] [1131] [1132] [1133] [1134] [1135] [1136] [1137] [1138] [1139] [1140] [1141] [1142] [1143] [1144] [1145] [1146] [1147] [1148] [1149] [1150] [1151] [1152] [1153] [1154] [1155] [1156] [1157] [1158] [1159] [1160] [1161] [1162] [1163] [1164] [1165] [1166] [1167] [1168] [1169] [1170] [1171] [1172] [1173] [1174] [1175] [1176] [1177] [1178] [1179] [1180] [1181]

BS: The Mother of all BS threads

Bee-dubya-ell 26 Mar 04 - 09:43 PM
GUEST,Pussy Galore 26 Mar 04 - 04:54 PM
Amos 26 Mar 04 - 04:12 PM
Rapparee 26 Mar 04 - 03:38 PM
Skipjack K8 26 Mar 04 - 02:24 PM
Amos 26 Mar 04 - 01:34 PM
Rapparee 26 Mar 04 - 01:26 PM
Bee-dubya-ell 25 Mar 04 - 08:45 PM
Amos 25 Mar 04 - 08:13 PM
Rapparee 25 Mar 04 - 08:04 PM
Amos 25 Mar 04 - 07:20 PM
GUEST,Shlio 25 Mar 04 - 06:51 PM
Rapparee 25 Mar 04 - 06:50 PM
Amos 25 Mar 04 - 06:47 PM
GUEST,Shlio 25 Mar 04 - 06:26 PM
Bee-dubya-ell 25 Mar 04 - 05:27 PM
Amos 25 Mar 04 - 01:05 PM
Rapparee 25 Mar 04 - 01:01 PM
Little Hawk 25 Mar 04 - 12:14 PM
Amos 25 Mar 04 - 11:57 AM
Rapparee 25 Mar 04 - 11:42 AM
Amos 25 Mar 04 - 11:31 AM
Little Hawk 25 Mar 04 - 11:12 AM
Amos 25 Mar 04 - 09:02 AM
Tweed 25 Mar 04 - 07:40 AM
Rapparee 24 Mar 04 - 04:48 PM
Amos 24 Mar 04 - 04:34 PM
Rapparee 24 Mar 04 - 03:42 PM
Amos 24 Mar 04 - 02:51 PM
Rapparee 24 Mar 04 - 02:35 PM
GUEST,Shlio 24 Mar 04 - 07:09 AM
Amos 23 Mar 04 - 06:04 PM
Rapparee 23 Mar 04 - 04:29 PM
Amos 23 Mar 04 - 03:50 PM
GUEST,Shlio 23 Mar 04 - 03:14 PM
Rapparee 23 Mar 04 - 01:14 PM
Rapparee 23 Mar 04 - 11:56 AM
Bee-dubya-ell 23 Mar 04 - 11:26 AM
Amos 23 Mar 04 - 10:59 AM
Bee-dubya-ell 23 Mar 04 - 10:51 AM
Bee-dubya-ell 23 Mar 04 - 10:50 AM
Amos 23 Mar 04 - 09:10 AM
Rapparee 23 Mar 04 - 08:55 AM
Amos 22 Mar 04 - 11:44 AM
Rapparee 21 Mar 04 - 08:42 PM
Amos 21 Mar 04 - 08:17 PM
Amos 21 Mar 04 - 11:52 AM
GUEST,Shlio 21 Mar 04 - 11:14 AM
Amos 21 Mar 04 - 10:28 AM
Bee-dubya-ell 21 Mar 04 - 10:13 AM

Share Thread
Lyrics & Knowledge Search [Advanced]
DT  Forum
Sort (Forum) by:relevance date
DT Lyrics:

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 26 Mar 04 - 09:43 PM

Sorry, Rap, I'm still in mourning for Bubba Bubba. Talk to me after a year has gone by.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Pussy Galore
Date: 26 Mar 04 - 04:54 PM

And he loves cats!

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 26 Mar 04 - 04:12 PM

Brucie not female? Well -- I wouldn't go THAT far...he certainly gives it all he's got!
But there are some orgnic varieties in these parts make him look like mere shadowstuff.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 26 Mar 04 - 03:38 PM

Amos, are you implying that Bee-dubya isn't, well, female????

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Skipjack K8
Date: 26 Mar 04 - 02:24 PM

I'm worried that my contribution is a little premature, and that this fledgling thread still might not catch on. I'm also a certified thread killer, so this has probably consigned this thread to Davy Jones' Locker.

That's an each-way bet to kill this mother.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 26 Mar 04 - 01:34 PM

There you have it, TV Viewers -- it is suddenly revealed that BWL was merely pulling strings to set me up in an effort to dump Rapaire his own self. Now, I know that affairs of the heart are complicated and tricky -- but we have to maintain stability here. So you boys go off and have your tete-a-tete and sort out the destiny of your relationship and I'll go one dreaming about the womenfolk of Mudcat far and wide. Some further, and some wider... 'Kay? Thanks.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 26 Mar 04 - 01:26 PM

But, Bee-dubya, what about us?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 25 Mar 04 - 08:45 PM

See, just like an old married couple. Bitch, bitch, bitch about nothing of any consequence and then, BOOM! "I love you!"

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 08:13 PM

I love ya, man.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 08:04 PM

I'm a true pod! Nothing psuedo about me!

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 07:20 PM

And, just BTW, what the hell do you mean PSEUDO-intellectual??

I am an intellectual. Rapaire is a pseudopod.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 25 Mar 04 - 06:51 PM

On the other hand...Who would post to MOAB ?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 06:50 PM

And I'm stunningly good looking.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 06:47 PM

Excellent, excellent idea, with only one fatal flaw. I'm ugly.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 25 Mar 04 - 06:26 PM

Well, it would mean that they could have their cosy DNA and soap chats in the privacy of their own home...stop giving us poor readers headaches...

Sounds like a good idea!

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 25 Mar 04 - 05:27 PM

After reading several of Amos and Rapaire's little pseudo-intellectual sparring matches I've come to an inescapable conclusion: You guys really should get married.

Think about it! We haven't yet had a MOAB wedding! It'd be fun. We could send out invitations. Khandu could preside and Joe Offer could give away the bride. We could do it live in the Mudchat room if we wanted.

Yeah, I know, Amos and Rapaire are probably gonna make with a buncha "but I'm already married" noise and "but I'm not gay" crap. So, get friggin' divorces! People do it all the time for helluva lot worse reasons. And don't worry about the gay thing. You guys are too old for sex of any kind anyway.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 01:05 PM

Hellenic Hint # 3: Don't use scouring powder on young boys, Rapire.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 01:01 PM

Hellenic Hint #2: Have Amos pick up the soap for you.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 25 Mar 04 - 12:14 PM

You live on this thread don't you, Amos? :-)

Mr Chongo is getting restless. He wants to do another story.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 11:57 AM


See this reference


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 25 Mar 04 - 11:42 AM

Hellenic hint: Just let the soap lay there on the floor.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 11:31 AM

Little Hawk has succumbed to the delusion that he is still a primate.

This is a great loss to the MOAB, as his lucid rationalisms will be buried in the language of the lizard-brained Silverbacks and we will not be able to understand him.

On the other hand, think of the disk space we'll save!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Little Hawk
Date: 25 Mar 04 - 11:12 AM

N'hurgy! N'hurgy! Nyaaaahhhh!!! Wacka! Wacka! Freeble.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 25 Mar 04 - 09:02 AM

Hellenic Hint:

Don't use scouring powder on large wooden horses as it causes those within to sneeze.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Tweed
Date: 25 Mar 04 - 07:40 AM

DNA Discorses?? Pitiful!...a mos' pitimous attempt at BS. Surely thar must be someone wif a Hellenic Hint fore the use obv scouring powder to remove corns and callussez....

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 04:48 PM

I suppose that could be. I understand, from the article I read on it, that Musscheiss's methodology was to to count the number of genetic pentagroups in the DNA segment and multiply, in base 10, by 5.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 24 Mar 04 - 04:34 PM

Obviously Liebenscheiss and Mussscheiss disagree by an order of magnitude.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 03:42 PM

That's Musscheiss's figure, Amos, not mine.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 24 Mar 04 - 02:51 PM

I don't think pi x 10^37 is right, Rapaire. Where did you get that figure from? I am sure it is an order of magnitude high.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 24 Mar 04 - 02:35 PM

In a little known recent development, the Human Genome Project has discovered that
everyone is born with a finite number of possible keystrokes. Dr. Stanley Musscheiss,
Deputy Director of the Project’s ATGGTAGGAATTAGGTAGTA Section reported late
yesterday (that would have been around 1816 EST, 23 March 2004) that research in his
section “absolutely confirmed beyond any shadow of a doubt” that anyone sharing his
sectional DNA sequence “will almost always” be limited to no more than 3.14159265 x
1037 keystrokes in a normal lifetime. When asked about this number being so similar to π,
he replied, “Amazing that a reporter like you would notice that too.”

Unless you want to be profligate with your lifetime supply of keystrokes, you might want
to have your DNA sequenced. Remember, once they’re gone, they’re gone.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 24 Mar 04 - 07:09 AM

Besides, for us slow typers, HTML takes too long to use it on such a common word as MOAB

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 06:04 PM

Terrible about ole Rapaire -- world's first case of Parkinson in ASCII ever recorded!!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 04:29 PM

Wwhat, Aamos? Yyou ddon't kknow Wwelsh?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 03:50 PM


How nice that you have mastered the "X" of XML.

But there is only one "T" in "Those".


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 23 Mar 04 - 03:14 PM

Hey! I can do italics now!

I just happen to be a slow learner.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 01:14 PM

Tthose who cannot cope with simple HTML most certainly will never be able to cope with XML ! ! !

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 11:56 AM

Mayhap, Bee-Dubya, it's because some of us Moabites don't know HTML and really don't want to learn it?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 11:26 AM

My problem's not with my face folding, but with it stretching. My face used to end about 1 1/2" above my eyebrows, where it met my hairline. Then it began stretching. Unfortunately, as the face stretched the head itself didn't grow to accomodate more face. So, that hairline just kept being pushed further and further back. Now, my face extends back a full 10" from my eyebrows.

Meanwhile, a lot of that displaced hair seems to have migrated to the lower part of my face, but that's another story.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 10:59 AM

Foldface is a new wrinkle on typography, appropriate for aging boomers all over the land who have first-hand experience with their faces folding more and more each year.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 10:51 AM

Don't ask me what in the buck "foldface" type is.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 23 Mar 04 - 10:50 AM

I have noticed that I seem to be the only MOABite who has held to the convention of using boldface type when typing MOAB or Mother of all BS threads. Emboldening the holy name of this thread (as was done by the Prophet khandu on MOAB Day One) indicates a level of reverance above and beyond that of those who simply type "MOAB".

Now, I don't have any problem with you let's-do-it-the-easy-way backsliders being too lazy to type an extra seven keystrokes if that's the extent of your faith, but I personally wish to proclaim the name of MOAB boldly.

Yes, you can call be a MOAB fundamentalist if you wish. It's the truth. I don't deny it. And I challenge you to join me. Yes, to join me under the MOAB Revival Tent. Stand up and say, "I'm a MOABite and proud of it! And I will always refer to our MOAB in foldface type! Now hand me one of those snakes!"

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 23 Mar 04 - 09:10 AM

(Sings)Venn the veil made shtrike
Undt der line paid out
Undt der veil made a blunder mitt her tail.....

I refuse to engage in More Meaningless Machinations Making More Mealymouth Overblown Acronyms, Brother! (MMMMMMOAB!)


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 23 Mar 04 - 08:55 AM

No, no, Amos! MOAB has taken the veil! You may now refer to Mother as Merry Mother Mary MOAB, SDF.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 22 Mar 04 - 11:44 AM

MOAB pentrates the Veil? Wow. (I love that idea -- one of my favorite conceits is that our laughter ripples through the Universe of the Spirits and shifts the fate of nations by lightening things up a bit at the Source). So here's to you, Rick -- you always made things lighter!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Rapparee
Date: 21 Mar 04 - 08:42 PM

Damned straight, Amos. But I'd like to think that MOAB's and Mudcat's reach extends to Rick even now.

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 08:17 PM

Death is a place where even MOAB's reach will not avail and all the laughter stills; there is no BS like the cosmic crap that says Rick Fielding has to go be someone else, and we take the loss of it. Now that, friends, is BS. I protest it to my shoes.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 11:52 AM

There ya go. Shlio-who-is-not-Shhilo has aspoken!

Let it be so!!

Shatner's outta here and Khandu is on his long wayback to MOAB!!

Hurray for Khanduuuu!

Down with Shatner!!


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: GUEST,Shlio
Date: 21 Mar 04 - 11:14 AM

Personally I would be happy to sacrifice Shatner to get Khandu back. Heck, I'd give Shatner away even if Khandu hadn't been kidnapped.

But not Dylan, okay?

Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Amos
Date: 21 Mar 04 - 10:28 AM

Lenin would've just been another wanker.

Which indeed would have changed very little.


Post - Top - Home - Printer Friendly - Translate

Subject: RE: BS: The Mother of all BS threads
From: Bee-dubya-ell
Date: 21 Mar 04 - 10:13 AM

Khandu does these periodic disappearing acts so the rest of us can entertain ourselves by making up goofy shit about his whereabouts. Truly a mark of enlightened royalty - making sure the rabble has something to do other than staging revolts. If the Romanovs had only invented the Internet and given away free memberships to "Asian Babes with Big Bazoongas" Lenin would've just been another wanker.

Post - Top - Home - Printer Friendly - Translate
Next Page


You must be a member to post in non-music threads. Join here.

You must be a member to post in non-music threads. Join here.

Mudcat time: 15 June 9:14 PM EDT

[ Home ]

All original material is copyright © 1998 by the Mudcat Café Music Foundation, Inc. All photos, music, images, etc. are copyright © by their rightful owners. Every effort is taken to attribute appropriate copyright to images, content, music, etc. We are not a copyright resource.